bioinformatics - How to use linux command to extract sequencing data -

-

i extract lines , following sequencing data.

there ecoli.ffn file follows:

$head ecoli.ffn >ecoli16:g027092:gcf_000460315:gi|545267691|ref|nz_ke701669.1|:551259-572036 atgagcctgattattgatgttatttcgcgt aaaacatccgtcaaacaaacgctgattaat >ecoli16:g000011:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat >ecoli16:g000012:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc

and index.txt following

$head index.txt g000011 g000012

what want "extract index.txt ecoli.ffn", ideal output is:

>ecoli16:g000011:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat >ecoli16:g000012:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc

how can this?

write simple script ecoli.sh using awk:

#!/bin/bash a=`cat index.txt` in $a     cat ecoli.ffn|awk -f: -v i="$i" 'begin{flag=0} {if($2 == i){print $0;flag=1;} if(flag ==1 && $2 != i){print $0; flag=0;} }' done

then need run script in shell.


Comments

Post a Comment

Popular posts from this blog

java - nested exception is org.hibernate.exception.SQLGrammarException: could not extract ResultSet Hibernate+SpringMVC -

-
i trying fetch records database , having above error this classs appropriate getters , setters public class user { private int id; private string username; private string password; private string email; i have create database , inserted data below configuration <bean id="datasource" class="org.apache.commons.dbcp2.basicdatasource" destroy-method="close"> <property name="driverclassname" value="com.mysql.jdbc.driver"/> <property name="url" value="jdbc:mysql://localhost:3306/usersdb"/> <property name="username" value="root"/> <property name="password" value=""/> </bean> this complete stacktrace severe: servlet.service() servlet [appservlet] in context path [/spring] threw exception [request processing failed; nested exception org.hibernate.exception.sqlgrammarexception: not ...
Read more

sql - Postgresql tables exists, but getting "relation does not exist" when querying -

-
Image
i have postgresql db number of tables. if query: select column_name information_schema.columns table_name="my_table"; i list of columns returned properly. however, when query: select * "my_table"; i error: (programmingerror) relation "my_table" not exist 'select *\n "my_table"\n' {} any thoughts on why can columns, can't query table? goal able query table. you have include schema if isnt public one select * <schema>."my_table" or can change default schema show search_path; set search_path my_schema; check table schema here select * information_schema.columns for example if table on default schema public both works ok select * parroquias_region select * public.parroquias_region but sectors need specify schema select * map_update.sectores_point
Read more

asp.net mvc - breakpoint on javascript in CSHTML? -

-
i have .cshtml file has javascript tag. within script tag have few lines of javascript. first line of javascript refers property in @viewbag. other javascript lines plain script without mvc related references. observation: can place breakpoints (visual studio 2015) on each of these javascript lines. however, breakpoints has white dot in center of breakpoint symbol (red circle) except line @viewbag reference (this particular line not have white dot in center). it seems breakpoint without white dot hit during run-time. question: can explain going on here? white dot mean? why plain red breakpoint line line hitting breakpoint? the visual studio debugger expecting debug actual server-side code within .cshtml file opposed client-side javascript within it. iirc, visual studio allow debug javascript code expected in internet explorer (and possibly edge), other browsers want use either third-party tool or developer tools (f12) within browser. an easy approach take advant...
Read more