bioinformatics - How to use linux command to extract sequencing data -


i extract lines , following sequencing data.

there ecoli.ffn file follows:

$head ecoli.ffn >ecoli16:g027092:gcf_000460315:gi|545267691|ref|nz_ke701669.1|:551259-572036 atgagcctgattattgatgttatttcgcgt aaaacatccgtcaaacaaacgctgattaat >ecoli16:g000011:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat >ecoli16:g000012:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc 

and index.txt following

$head index.txt g000011 g000012 

what want "extract index.txt ecoli.ffn", ideal output is:

>ecoli16:g000011:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat >ecoli16:g000012:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc 

how can this?

write simple script ecoli.sh using awk:

#!/bin/bash a=`cat index.txt` in $a     cat ecoli.ffn|awk -f: -v i="$i" 'begin{flag=0} {if($2 == i){print $0;flag=1;} if(flag ==1 && $2 != i){print $0; flag=0;} }' done 

then need run script in shell.


Comments

Popular posts from this blog

compilation - PHP install fails on Ubuntu 14 (make: *** [sapi/cli/php] Error 1) PHP 5.6.20 -

javascript - return highlighted cells to php -

java - Creating a room by reading from a file (for a game) -